View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20966_high_40 (Length: 230)

Name: NF20966_high_40
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20966_high_40
NF20966_high_40
[»] chr1 (1 HSPs)
chr1 (14-212)||(14633069-14633267)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 212
Target Start/End: Complemental strand, 14633267 - 14633069
Alignment:
14 catagggcaaagagtaagaatcaaacgagagtccgagacgtcgaacggagcggaatatcgaaacagcgagtttagcgtttgatgagtaaagtgcgtagat 113  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14633267 cataaggcaaagagtaagaatcaaacgagagtccgagacgtcgaacggagcggaatatcgaaacagcgagtttagcgtttgatgagtaaagtgcgtagat 14633168  T
114 gatgttgttgtagacgaagatgggaaatggacggttgtgattgaaggtgaagatggagtaggagtaggatgggtaattgagggaagcggttttgtgaat 212  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
14633167 gatgttgttgtagacgaagatgggaaatggacggttgtgattgaaggtgaagattgagtaggagtaggatgggtaattgagggaagcggttttgtgaat 14633069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University