View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_high_9 (Length: 379)
Name: NF20966_high_9
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 16 - 376
Target Start/End: Complemental strand, 41724916 - 41724556
Alignment:
| Q |
16 |
cttttcacaaacttcttcagtcaaagtttccatcatttctaactgtttttcacctggttttctcttcacaatcttgactctagaccatacaggatcttga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41724916 |
cttttcacaaacttcttcagtcaaagtttccatcatttctaactgtttttcacctggttttctcttcacaatcttgactctagaccatacaggatcttga |
41724817 |
T |
 |
| Q |
116 |
gtgatttctgaagattgtggggacaaattagagttgtttctaaagcagtttgaaggcctcaattttgaagcaaattggtctttcagagaattaatttcat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
41724816 |
gtgatttctgaagattgtggggacaaattagagttgtttctaaagcagtttgaaggcctcaattttgaagcaaattggtctttcagagaattaattgcat |
41724717 |
T |
 |
| Q |
216 |
cctctctctccaacaataagctttccaatttcatcttgtcatgtctcagctgtgtcacatccttgaccaagccctccaagtgtgactgaagctgctttgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41724716 |
cctctctctccaacaataagctttccaatttcatcttgtcatgtctcagctgtgtcacatccttcaccaagccctccaagtgtgactgaagctgctttgt |
41724617 |
T |
 |
| Q |
316 |
ttctaattctgttctcaacaattgccacctaaatgcctctaacttctcatctctgctcctc |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
41724616 |
ttctaattctgttctcaacaattgccacctaaatgcctctaacttctcatctttgatcctc |
41724556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University