View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_11 (Length: 356)
Name: NF20966_low_11
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 20 - 347
Target Start/End: Complemental strand, 881374 - 881046
Alignment:
| Q |
20 |
tgaatcatatatctcgagagtccaacgacataaaccgccttgccaaattctatcaagaggtaaccactcatcacataacaacttatttgtctcaattaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| |
|
|
| T |
881374 |
tgaatcatatatctcgagagtccaacgacataaaccgccttgccaaattctatcaagaggtaaccactgatcacataacaacttgtttgtctcaatcaaa |
881275 |
T |
|
| Q |
120 |
attcacatgtttggaattttt-attgtatgattttcagatatttggatttgaagaagtagaaagccccaagttcggagagtttaaggttgtatggctacg |
218 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
881274 |
attcacatatttggaattttttattgtatgattttcagatatttggatttgaagaagtagaaagccccaagttcggagagtttaaggttgtatggctacg |
881175 |
T |
|
| Q |
219 |
tgttccatcttcttccttatatcttcacctcatcgagcgcaacccatctaacaatctccctgaaggtccatggagtgccacctctcctgttaaagaccct |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
881174 |
tgttccatcttcttcattatatcttcacctcatcgagcgcaacccatctaacaatctccctgaaggtccatggagtgccacctctcctgttaaagaccct |
881075 |
T |
|
| Q |
319 |
tcccatcttcctagaggccatcatctctg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
881074 |
tcccatcttcctagaggccatcatctctg |
881046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University