View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20966_low_21 (Length: 308)

Name: NF20966_low_21
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20966_low_21
NF20966_low_21
[»] chr5 (1 HSPs)
chr5 (18-279)||(14771643-14771888)


Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 14771888 - 14771643
Alignment:
18 aacatcactcaaaaattcaaaatctaaacagtgcaaaagcatctacccagaaagaatggatgcagaaagaatggatgcagcctgcttttggctaagctac 117  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||               ||||||||||||||||||||    
14771888 aacatcactcaaaaattcaaaatctaaacagtgcaaaagtatctacccagaaagaatggatgcag---------------cctgcttttggctaagctac 14771804  T
118 attctcttttaacaataaaggcnnnnnnnnacgccatctattctagagtttagcacaaatccccatagcagtatcgtgaaaaattggattggattgctgc 217  Q
    ||||||||||||||||||||||        ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
14771803 attctcttttaacaataaaggcttttttt-acgccatctattctagagtttagcacaaacccccatagcagtatcgtgaaaaattggattggattgctgc 14771705  T
218 cgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgattgagattgg 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14771704 cgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgattgagattgg 14771643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University