View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_21 (Length: 308)
Name: NF20966_low_21
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 18 - 279
Target Start/End: Complemental strand, 14771888 - 14771643
Alignment:
| Q |
18 |
aacatcactcaaaaattcaaaatctaaacagtgcaaaagcatctacccagaaagaatggatgcagaaagaatggatgcagcctgcttttggctaagctac |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14771888 |
aacatcactcaaaaattcaaaatctaaacagtgcaaaagtatctacccagaaagaatggatgcag---------------cctgcttttggctaagctac |
14771804 |
T |
 |
| Q |
118 |
attctcttttaacaataaaggcnnnnnnnnacgccatctattctagagtttagcacaaatccccatagcagtatcgtgaaaaattggattggattgctgc |
217 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14771803 |
attctcttttaacaataaaggcttttttt-acgccatctattctagagtttagcacaaacccccatagcagtatcgtgaaaaattggattggattgctgc |
14771705 |
T |
 |
| Q |
218 |
cgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgattgagattgg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14771704 |
cgattctcattatagaggaaaaaataattaagaattatgttgtgattgatgattgagattgg |
14771643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University