View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_31 (Length: 251)
Name: NF20966_low_31
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 4795104 - 4795329
Alignment:
| Q |
19 |
atagtaataaatattatgtgtcgtgaactgattggttggcactagccatcccagctcatctggctca---aaattcacaacacacgaatgactctgaaaa |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4795104 |
atagtaataaatattaggtgtcgtgaactgattggttggcactagccatcccagctcatctggctcatcaaaattcacaacacacgaatgactctgaaaa |
4795203 |
T |
 |
| Q |
116 |
atgaacaacgattttgtt-----atgacacaacaaccactggaacttagtttaaaattgaaagcaaatagatacaattatttggaaagttttcgttcctt |
210 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4795204 |
atgaacaacgattttgttatgttatgacacaacaaccactggaacttagtttaaaattgaaagcaaatagatacaattatttggaaagttttcgttcctt |
4795303 |
T |
 |
| Q |
211 |
tgctatatggcagcatcatccccttt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4795304 |
tgctatatggcagcatcatccccttt |
4795329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University