View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_38 (Length: 237)
Name: NF20966_low_38
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_38 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 53214522 - 53214743
Alignment:
| Q |
1 |
tcttgtatttgactggttcagattaaataatccaaaatatgacaaaaccctcaatgcagaagtttttgcacattcttgacatgttttagatgtaatgatc |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53214522 |
tcttgtatttgactgattcagattaaataatccaaaatatgacaaaaccctcaatgcagaagtttttgcacattcttgacatgtttcagatgtaatgatc |
53214621 |
T |
|
| Q |
101 |
tgaaccactaaaatattgtttatggattatattatttgaaacatcccgagaacatggacaacattattgccaccgaggtttggctgatgggtggcattgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53214622 |
tgaaccactaaaatattgtttatggattatattatttgaaacatcccgagaacatggacaacattattgccaccgaggtttggctgatgggtggcattgt |
53214721 |
T |
|
| Q |
201 |
caacaacctttgactggttagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53214722 |
caacaacctttgactggttagt |
53214743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University