View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_41 (Length: 233)
Name: NF20966_low_41
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_41 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 43574407 - 43574610
Alignment:
| Q |
11 |
agcacagatgcaataacataaacattacacattctattatatatcattcatgacaatcaattattgttatctttattgaacagcttcgtgacaggtcatg |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43574407 |
agcacggatgcaataacataaacattacacattctattatatatcattcatgacaatcaattattgttatctttattgaacagcttcgtgacaggtcatg |
43574506 |
T |
|
| Q |
111 |
tgaacgaaaattctttgctttcaagtacatatttcaaacaactaatcatcacaagctaaataaaaatgattgcctataaattgctgccataaatatcact |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43574507 |
cgaacgaaaattctttgctttcaagtacatatttcaaacaactaatcatcacaagctaaataaaaatgattgcctataaattgctaccataaatatcact |
43574606 |
T |
|
| Q |
211 |
tata |
214 |
Q |
| |
|
|||| |
|
|
| T |
43574607 |
tata |
43574610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University