View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_42 (Length: 230)
Name: NF20966_low_42
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 212
Target Start/End: Complemental strand, 14633267 - 14633069
Alignment:
| Q |
14 |
catagggcaaagagtaagaatcaaacgagagtccgagacgtcgaacggagcggaatatcgaaacagcgagtttagcgtttgatgagtaaagtgcgtagat |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14633267 |
cataaggcaaagagtaagaatcaaacgagagtccgagacgtcgaacggagcggaatatcgaaacagcgagtttagcgtttgatgagtaaagtgcgtagat |
14633168 |
T |
|
| Q |
114 |
gatgttgttgtagacgaagatgggaaatggacggttgtgattgaaggtgaagatggagtaggagtaggatgggtaattgagggaagcggttttgtgaat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14633167 |
gatgttgttgtagacgaagatgggaaatggacggttgtgattgaaggtgaagattgagtaggagtaggatgggtaattgagggaagcggttttgtgaat |
14633069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University