View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20966_low_43 (Length: 224)
Name: NF20966_low_43
Description: NF20966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20966_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 74 - 202
Target Start/End: Complemental strand, 27817716 - 27817583
Alignment:
| Q |
74 |
tgaaacaattcttgtgtggtcacaactacaaatataattgttttag-----catacaaatggacataagtnnnnnnnnnnnnnnnnntcaatttattttt |
168 |
Q |
| |
|
||||||||||||| || |||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||||| || |
|
|
| T |
27817716 |
tgaaacaattcttacgtagtcacaactataaatataattgttttaggtatacatacaaatggacataagtaaaaagacaaaaaaaaatcaatttattgtt |
27817617 |
T |
 |
| Q |
169 |
attatgattgaaaatattagttaatgtatatcgt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27817616 |
attatgattgaaaatattagttaatgtatatcgt |
27817583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 86
Target Start/End: Complemental strand, 27817776 - 27817740
Alignment:
| Q |
50 |
acaaaagaaatttgtatatcaatgtgaaacaattctt |
86 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27817776 |
acaaaagaaatttgtatatcaatatgaaacaattctt |
27817740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 119
Target Start/End: Complemental strand, 8737009 - 8736973
Alignment:
| Q |
83 |
tcttgtgtggtcacaactacaaatataattgttttag |
119 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8737009 |
tcttgtatggtcacaactacaaatataattggtttag |
8736973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University