View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_18 (Length: 282)
Name: NF20967_low_18
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 26495860 - 26495579
Alignment:
| Q |
1 |
catgggttattgctcatctttatcctttccttaaaggactaatgggaagacagaatagaacaccaactcttgttgtcatttggtctgtgcttttggcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495860 |
catgggttattgctcatctttatcctttccttaaaggactaatgggaagacagaatagaacaccaactcttgttgtcatttggtctgtgcttttggcttc |
26495761 |
T |
 |
| Q |
101 |
tatcttttctttggtttgggtaagaatcgacccttttgtgttgaaaactaaggggcctgatgttaagcaatgtggaattagttgttgaatttgtttattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495760 |
tatcttttctttggtttgggtaagaatcgacccttttgtgttgaaaactaaggggcctgatgttaagcaatgtggaattagttgttgaatttgtttattt |
26495661 |
T |
 |
| Q |
201 |
acccaaatgaatgatgtgagccaaaagaaaagttttgtgaaatacatgcaagctatgttgcactaacacttcgaattaaaga |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495660 |
acccaaatgaatgatgtgagccaaaagaaaagttttgtgaaatacatgcaagctatgttgcactaacacttcgaattaaaga |
26495579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 70 - 161
Target Start/End: Complemental strand, 54381057 - 54380966
Alignment:
| Q |
70 |
ttgttgtcatttggtctgtgcttttggcttctatcttttctttggtttgggtaagaatcgacccttttgtgttgaaaactaaggggcctgat |
161 |
Q |
| |
|
||||||| || ||||| ||| | |||||||| || || |||||| | ||||||||||| ||||| || ||| ||||||||||||| |||||| |
|
|
| T |
54381057 |
ttgttgtgatatggtcagtgttgttggcttccattttctctttgttatgggtaagaattgacccattcgtgatgaaaactaagggacctgat |
54380966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University