View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_21 (Length: 261)
Name: NF20967_low_21
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_21 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 123 - 261
Target Start/End: Complemental strand, 23165841 - 23165703
Alignment:
| Q |
123 |
tcttgcgctgttactagttcaggacaaaataagaataacaattacccacatacacaacacagtagagctcttcaactgttccactttatttacattaact |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23165841 |
tcttgcgctgttactagttcaggacaaaataagaataacaattacccacatacacaacacagtagagctcttcaactgttccactttatttacattaact |
23165742 |
T |
 |
| Q |
223 |
aaatgcaaacttcgagctacattcaaaagggacatcatt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23165741 |
aaatgcaaacttcgagctacattcaaaagggacatcatt |
23165703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 23165948 - 23165892
Alignment:
| Q |
16 |
tgtgcaaaactatgataccggtagaaatattaatgacacttattatgctaagcttat |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23165948 |
tgtgcaaaactatgataccggtagaaatattaatgacacttattatgctaagcttat |
23165892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University