View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_23 (Length: 246)
Name: NF20967_low_23
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 71 - 236
Target Start/End: Original strand, 45411278 - 45411442
Alignment:
| Q |
71 |
ttttttgaaatttgcattgcattaacttactttggaaattattttaacttgatgatgggtactttggtcatttttgtaaataatttctccacacaggann |
170 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45411278 |
tttttttaaatttgcattgcattaacttactttggaaattattttaacttgatgatgggtactttggtcatttttgtaaatagtttctccacacagga-- |
45411375 |
T |
 |
| Q |
171 |
nnnnnnnggtccatgact-ggctaccacatcagacatggtccccaccaagatcttccattttctgtg |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45411376 |
tttttttggtccatgactgggctaccacatcagacatggtccccaccaagatcttccattttctgtg |
45411442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 45411186 - 45411262
Alignment:
| Q |
1 |
ttaggaaccaacttttccacttgttttcttcacatgtacaaaatgtctaaattggtcgcattgcattaacttttttga |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45411186 |
ttaggaaccaacttttccacttgttttcttcacatgta-aaaatgtctaaattggtcgcattgcattaacttttttga |
45411262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University