View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_26 (Length: 240)
Name: NF20967_low_26
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 240
Target Start/End: Original strand, 45410936 - 45411161
Alignment:
| Q |
15 |
aaagggaatttagtttgagaaattaaataagttatgtgataatgtgggaccaatcatatatacctgtcctttgtgtgaaaagtgtggtttggtatagaaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45410936 |
aaagggaatttagtttgagaaattaaataagttatgtgataatgtgggaccaatcatatatacctgtcctttgtgtgaaaagtgtggtttggtatagaaa |
45411035 |
T |
 |
| Q |
115 |
cccaccattgtagcgttttacctttgtattttggtgcaattggtttaactactaagtgctaacaaagcaaaaaatatcccatgccaggttatttcagcct |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45411036 |
cccaccattgtagcgttttacctttgtattttggtgcaattggtttaactactaagtgctaacaaagcaaaaaatatcccatgccaggttatttcagcct |
45411135 |
T |
 |
| Q |
215 |
aattaggtcatttatgtataagaatc |
240 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
45411136 |
aattaggtcatttatgtgtaagaatc |
45411161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University