View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_27 (Length: 238)
Name: NF20967_low_27
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 26495559 - 26495335
Alignment:
| Q |
1 |
cgtgttggaattattg---atgttgacgtgtcagtgtcatatctagtgactgtattcgtgtctgtgttgatgcttcatagcatgcaagggagagcacttt |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26495559 |
cgtgttggaattattgttgatgttgacgtgtcagtgtcgtatctagtgactgtattcgtgtctgtgttgatgcctcatagcatgcaagggagagcacttt |
26495460 |
T |
 |
| Q |
98 |
gtacttattttgtaattagaggaacagaacaaaagttgtttacttgtgatttttcat-ttttggctccatgtgaggttgtgatgacttaatttattcaac |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26495459 |
gtacttattttgtaattagaggaacaaaacaaaagttgtttacttgtgatttttcattttttggctccatgtgaggttgtgatgacttaatttattcaac |
26495360 |
T |
 |
| Q |
197 |
taataaagaaactgaacctagcacc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
26495359 |
taataaagaaactgaacctagcacc |
26495335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University