View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20967_low_29 (Length: 211)

Name: NF20967_low_29
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20967_low_29
NF20967_low_29
[»] chr4 (1 HSPs)
chr4 (19-149)||(56219731-56219861)


Alignment Details
Target: chr4 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 19 - 149
Target Start/End: Original strand, 56219731 - 56219861
Alignment:
19 ggggggtgtggaagtaaggattttgatcaagtggatttgggaaggttttgaggttggagatgtagtggttgagatgaggaagatcttttagcttaatggg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
56219731 ggggggtgtggaagtaaggattttgatcaagtggatttgggaaggttttgaggtttgagatgtagtggttgagatgaggaagatcttttagcttaatggg 56219830  T
119 ttcgaataagtttgttacatcttcgagttct 149  Q
    |||||||||||||||||||||||||||||||    
56219831 ttcgaataagtttgttacatcttcgagttct 56219861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University