View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20967_low_8 (Length: 468)
Name: NF20967_low_8
Description: NF20967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20967_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 369; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 16 - 400
Target Start/End: Original strand, 42667878 - 42668262
Alignment:
| Q |
16 |
attttgatcttcataagagcgtggactttcattgttgttgtttttgctaaggaagccacaaaatatggcaaagagaacaagcaaaaggttaagggaatcc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667878 |
attttgatcttcataagagcgtggactttcattgttgttgtttttgctaaggaagccacaaaatatggcaaagagaacaagcaaaaggttaagggaatcc |
42667977 |
T |
|
| Q |
116 |
caactcttttttaccgaattaggtttgaaaatgtgggaagcgaaagagtgcaatgtaggaactatgactaagatgaacgcaagtgcaattactagaagga |
215 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667978 |
caactcttttttactgaattaggattgaaaatgtgggaagcgaaagagtgcaatgtaggaactatgactaagatgaacgcaagtgcaattactagaagga |
42668077 |
T |
|
| Q |
216 |
ctatgataacagtgccggagctgaggaaaagtgagtatgagcgactgaggcggcggcggttggtgccactgttttgcagccagaagggtgaagaaatttg |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42668078 |
ctatgataacagtgccggagctgaggaaaagtgagtatgagcgactgaggcggcggcggttggtgccgctgttttgcagccagaagggtgaagaaatttg |
42668177 |
T |
|
| Q |
316 |
ttcctcttcttccatttagttttggtttgatgccaaatggttgatgttttgaaacttggtgtggaagaaaatatgatcttcaatt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42668178 |
ttcctcttcttccatttagttttggtttaatgccaaatggttgatgttttgaaacttggtgtggaagaaaatatgatcttcaatt |
42668262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 399 - 468
Target Start/End: Original strand, 42668288 - 42668357
Alignment:
| Q |
399 |
ttgctttggttttgttctgttctgttttttgtgctatttggttgcttatatagtgtggaatgtggatggc |
468 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42668288 |
ttgctttggtttttttttgttctgttttttgtgctctttggttgcttatatagtgtggaatgtggatggc |
42668357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University