View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20968_low_13 (Length: 308)
Name: NF20968_low_13
Description: NF20968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20968_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 20 - 296
Target Start/End: Complemental strand, 4039280 - 4039004
Alignment:
| Q |
20 |
tgaagtttgtgtcacattgtttgatttagattccatattcatttcatcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatg |
119 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4039280 |
tgaagtttctgtcacattgtttgatttagattccatattcatttcatcctccttgcagccattgttttcggttaaacacgattcaaaactactcgaaatg |
4039181 |
T |
|
| Q |
120 |
taatcgaattgtgcagtgtcattgatcaattcattgttgcttgtgctataatcctcatggtcattaaggaaatcagtgaactgatcaattgagaaatctt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
4039180 |
taatcgaattgtgcagtgtcattgatcaattcattgttgcttgtgctataatcctcatgatcattgaggaaatcagtgaattgatcaattgagaaatctt |
4039081 |
T |
|
| Q |
220 |
ttgataattctccatatgcatccacttgttgttgcatctcctgacgatcctgatcattggctcgttgttgctcccta |
296 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4039080 |
ttgatacttctccatatgcatccacttgttgttgcatctcctgacgatcgtgatcattggctcgttgttgctcccta |
4039004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University