View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20968_low_19 (Length: 267)
Name: NF20968_low_19
Description: NF20968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20968_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 30612099 - 30611917
Alignment:
| Q |
17 |
aacaacatgcatgtatgtatctataggtcccttgtgttgtgttcatctatctatctctcctcccataataacttttgaagacaaattttgaaacttaaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30612099 |
aacaacatgcatgtatgtatctatgggtcccttgtgttgtgtccatctatctatctctcctcccataataacttttgaagacaaattttgaaacttaaaa |
30612000 |
T |
|
| Q |
117 |
tcccagtctttatttatattctgtaccctatgccgtcttacttttaccaacaattttcattctcactgttattgactgtttgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30611999 |
tcccagtctttatttatattctgtaccctatgccgtcttacttttaccaacaattttcattctcactgttattgactgtttgt |
30611917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 258
Target Start/End: Complemental strand, 30611868 - 30611830
Alignment:
| Q |
220 |
aagtcttggatggacacggacccaaatggatagtattat |
258 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
30611868 |
aagtcttggatggacacgtactcaaatggatagtattat |
30611830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University