View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20968_low_27 (Length: 237)
Name: NF20968_low_27
Description: NF20968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20968_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 39952963 - 39953197
Alignment:
| Q |
1 |
acaagtattgtctaaacaaaaatggtccttttattctaacactaagcaacatttacta------------aaagagagaaa-cacaactagagtaatctg |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||| |||||||||||| |
|
|
| T |
39952963 |
acaagtattgtctaaacaaaaatggtccttttattctaacactaagcaacatttactaccaaaaaaaaaaaaaaagagaaaacacaattagagtaatctg |
39953062 |
T |
 |
| Q |
88 |
gaactatgctttgaaattcaccaaccaatcatgaaatcaatgaaacaagggaggtaatgcaatgatcaagtaacatcatttttcaaaagaaatatttctt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39953063 |
gaactatgctttgaaattcaccaaccaatcatgaaatcaatgaaacaagggaggcaatgcaatgatcaagtaacatcatttttcaaaagaaatatttctt |
39953162 |
T |
 |
| Q |
188 |
ttttcaaaaacatattgtcctaatatcttaattat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
39953163 |
ttttcaaaaacatattgtcctaatatcttaattat |
39953197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University