View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20969_low_20 (Length: 249)
Name: NF20969_low_20
Description: NF20969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20969_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 3088980 - 3088767
Alignment:
| Q |
23 |
agaagcaacatcatctgaccagattccctgcatacaagaaataataagttgattttatttggagccaataaaaaatccatgtgttcattcaatctaggaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088980 |
agaagcaacatcatctgaccagattccctgcatacaagaaataataagttgattttatttggagccaataaaaaatccatgtgttcattcaatctaggaa |
3088881 |
T |
 |
| Q |
123 |
gagtgacagaaaaatttaaataatgttacttacattggtatagtttttctcaatgtcttggaggaggagtgtcacatctttgtcatagtaatctgctaat |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3088880 |
gagtgacagaaaaatttaaataatgttacttacattggtatagtttttctcaatgtcttggaggaggagtgtcacatctttgtcatagtaatctgctaat |
3088781 |
T |
 |
| Q |
223 |
gctgtgagaataat |
236 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
3088780 |
gctgtgagaataat |
3088767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University