View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20969_low_22 (Length: 227)
Name: NF20969_low_22
Description: NF20969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20969_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 41621032 - 41620836
Alignment:
| Q |
14 |
gagtttggatcaatggttttggaatgcaaaaatttactttcgccnnnnnnncaacaaagcaatgttgtttatgttaagaggcaaagaaaataagtttcat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41621032 |
gagtttggatcaatggttttggaatgcaaaaatttactttcgcctttttttcaacaaagcaatgttgtttatgttaagaggcaaagaaaataagtttcat |
41620933 |
T |
|
| Q |
114 |
aatttagctagggctgcatcacaatcttgttctcaggtttttaaccaagctcctgattgtatcttgcatatcattgagaatgaaatggtgtaattat |
210 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620932 |
aatttagctagggctgcatcacagtcttgttctcaggtttttaaccaagctcctgattgtatcttgcatatcattgagaatgaaatggtgtaattat |
41620836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 41621227 - 41621104
Alignment:
| Q |
1 |
tgcgaaatgacgagagtttggatcaatggttttggaatgcaaaaatttactttcgccnnnnnnncaacaaagcaatgttgtttatgttaagaggcaaaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| || ||||||||||| |||||||||||||| || |
|
|
| T |
41621227 |
tgcgaaatgacgagagtttggatcaatggttttggaatgcaaaaatttactttcgtctttttttcaaaaatgcaatgttgttcatgttaagaggcaagga |
41621128 |
T |
|
| Q |
101 |
aaataagtttcataatttagctagggctgca |
131 |
Q |
| |
|
||| ||||||||||||||||||||| |
|
|
| T |
41621127 |
aaa-------cataatttagctagggctgca |
41621104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University