View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20969_low_8 (Length: 371)
Name: NF20969_low_8
Description: NF20969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20969_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 21 - 355
Target Start/End: Complemental strand, 40222302 - 40221967
Alignment:
| Q |
21 |
atatatgaggggg-ctataaaatggttctaattaattagctgttgcttcagattttgctatggaaatgtgagatttcaagatgaagtaggactatgtact |
119 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40222302 |
atatatgaggggggctataaaatggttctaattaattagctattgcttcagattttgctatggaaatgtgacatttcaagatgaagtaggactatgtact |
40222203 |
T |
 |
| Q |
120 |
ggatacagtggtatgattatgattcattgcttacatttttataaatttgtgttttatgctaacagggttcgatatctattagcatgagattgtaccatac |
219 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40222202 |
ggctacagtggtatgattatgattcattgcttacatttttgtaaatttgtggtttatgctaacagggttcgatatctattagcatgagattgtaccaaac |
40222103 |
T |
 |
| Q |
220 |
cacattctgcttcgtttgcactcacttggcctctggagagaaatgtggtgacgagttgcgtcgaaacttggacatcgcggaaatcatcaagagaactaaa |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40222102 |
cacattctgcttcgtttgcactcacttggcctctggagagaaatgtggtgacgagttgcgtcgaaacttggacatcgcggaaatcatcaagagaactaaa |
40222003 |
T |
 |
| Q |
320 |
ttttctcactcacttggtatactagaacatgagtaa |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
40222002 |
ttttctcactcacttggtatactagaacatgagtaa |
40221967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University