View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_high_15 (Length: 246)
Name: NF2096_high_15
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 56 - 239
Target Start/End: Original strand, 30075702 - 30075885
Alignment:
| Q |
56 |
taccttgaagatgtggaatggattgggtaaggttaaagagataaatagtggaatgagaatgagcaatggaattaaggaaattgagaatggaacgaagagc |
155 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30075702 |
taccttgaagatggggaatggattgggtaaggttaaagagataaatagtggaatcagaatgagcaatggaattaaggaaattgagaatggaacgaagagc |
30075801 |
T |
|
| Q |
156 |
acggagacgaagaaatgagaattcagcacgtgcatcccttagaccagtggtgagagcgagagtgacttcacgatataccctttg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30075802 |
acggagacgaagaaatgagaattcagcacgtgcatcccttagaccagtggtgagagcgagagtgacttcacgatataccctttg |
30075885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University