View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2096_high_15 (Length: 246)

Name: NF2096_high_15
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2096_high_15
NF2096_high_15
[»] chr4 (1 HSPs)
chr4 (56-239)||(30075702-30075885)


Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 56 - 239
Target Start/End: Original strand, 30075702 - 30075885
Alignment:
56 taccttgaagatgtggaatggattgggtaaggttaaagagataaatagtggaatgagaatgagcaatggaattaaggaaattgagaatggaacgaagagc 155  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
30075702 taccttgaagatggggaatggattgggtaaggttaaagagataaatagtggaatcagaatgagcaatggaattaaggaaattgagaatggaacgaagagc 30075801  T
156 acggagacgaagaaatgagaattcagcacgtgcatcccttagaccagtggtgagagcgagagtgacttcacgatataccctttg 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30075802 acggagacgaagaaatgagaattcagcacgtgcatcccttagaccagtggtgagagcgagagtgacttcacgatataccctttg 30075885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University