View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_high_18 (Length: 239)
Name: NF2096_high_18
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 30075635 - 30075411
Alignment:
| Q |
1 |
tcagacacacatttggtttgttttgattgttttatggttgtgttgctttcattacagtgcttccggttctctttcagcactctctaaaggagactgagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30075635 |
tcagacacacatttggtttgttttgattgttttatggttgtgttgctttcattacagtgcttccggttctctttcagcactctctaaaggagactgggaa |
30075536 |
T |
|
| Q |
101 |
tgattacaattacagtagggtaggagatgtgagtcatatatttggtgtggaacctatgaagttaacaagtccatccacagatgatgaaattgcacttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30075535 |
tgattacaattacagtagggtaggagatatgagtcatatatttggtgtggaacctatgaagttaacaagtccatccacagatgatgaaattgcacttgct |
30075436 |
T |
|
| Q |
201 |
cttagagttttggaaggatgttgtt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30075435 |
cttagagttttggaaggatgttgtt |
30075411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University