View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_high_20 (Length: 238)
Name: NF2096_high_20
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 10067685 - 10067477
Alignment:
| Q |
13 |
ataatactatgatgttgttttaacattttaatgctgtgttattagatggtgattttagctatgattccaattccacaaggctcagttccatatataacaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10067685 |
ataatactatgatgttgttttaacattttaatgctgtgttattagatggtgattttagctatgattccaattccacaaggctcagttccatatataacaa |
10067586 |
T |
 |
| Q |
113 |
aggattggttgaagtatacgataataacacaatacgcgccaagacttatgcgaatctatacgttgttcaatgaagtaacaagcacttctggtatattaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10067585 |
aggattggttgaagtatacgataataacacaatacgcgccaagacttatgcgaatctatacgttgttcaatgaagtaacaagcacttctggtatattaac |
10067486 |
T |
 |
| Q |
213 |
tgagacagc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
10067485 |
tgagacagc |
10067477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University