View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_high_21 (Length: 236)
Name: NF2096_high_21
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 28340619 - 28340821
Alignment:
| Q |
19 |
cacttttcacctcactcttaactgcttccccttccttcttaacaattaggttaagaannnnnnnnnnnnnnnnnnnncccccgactttcttcaattttcg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28340619 |
cacttttcacctcactcttaactgcttccccttccttcttaacaattaggttaagaatctctctctctctctctc--cccccgactttcttcaattttcg |
28340716 |
T |
 |
| Q |
119 |
aagcttcatatccttcgagttacaacctgcgatctgcttttccgaaattcacctttgtttcaaatgcaaataaattgatcaatgtctcaaccaccactct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28340717 |
aagcttcatatccttcgagttacaacctgcgatttgcttttccgaaattcacctttgtttcgaatgcaaataaattgatcaatgtctcaaccaccactct |
28340816 |
T |
 |
| Q |
219 |
ctgct |
223 |
Q |
| |
|
||||| |
|
|
| T |
28340817 |
ctgct |
28340821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University