View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_low_17 (Length: 247)
Name: NF2096_low_17
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 22 - 226
Target Start/End: Original strand, 4207140 - 4207344
Alignment:
| Q |
22 |
agtcgtaatgtactgttgcgcgatattaagcatttttgaattgtagtggatggtttgggatttaaacttccttattgtatttgttgttggctatgcattc |
121 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || |||||| | |||||||||||||| |||||||| |
|
|
| T |
4207140 |
agtcgtgatgtactgttgcgcgatattaagcatttttgaattgtagtggacggtttgggatttgaatttccttctcgtatttgttgttggttatgcattg |
4207239 |
T |
 |
| Q |
122 |
tctttagttcttgtttagctttttatgaccgtttgccttcatttttgtatcgtgtaacttattttcttggcatgtcttatgtcaagataaaataaatgaa |
221 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4207240 |
tctttagttcttgtttaactttttatgatcgtttgccttcacttttgtatcgtgtaacttattttcttggcatgtcttatgtcaagataaaataaatgaa |
4207339 |
T |
 |
| Q |
222 |
ttata |
226 |
Q |
| |
|
||||| |
|
|
| T |
4207340 |
ttata |
4207344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University