View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_low_21 (Length: 240)
Name: NF2096_low_21
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 112 - 223
Target Start/End: Original strand, 36285684 - 36285795
Alignment:
| Q |
112 |
ttatgaatagcattcaaacggcatgcaatggtccttatctcaaattgttggtattttgtgtaatatatgggacttcagcatttaaacttgattctctatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36285684 |
ttatgaatagcattcaaacggcatgcaatggtccttatctcaaattgttggtattttgtgtaatatatgggacttcagcatgtaaacttgattctctatc |
36285783 |
T |
 |
| Q |
212 |
tgtgggaagtct |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36285784 |
tgtgggaagtct |
36285795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 1 - 87
Target Start/End: Original strand, 36285586 - 36285672
Alignment:
| Q |
1 |
cttatgcatataaatggatcataaatttgttgattaatctttccatttcatccaggccttggtatacggcagagtagcttagagttc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36285586 |
cttatgcatataaatggatcataaatttgttgattaatctttccatttcatccaggccttggtatacggcagagtagcttagagttc |
36285672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University