View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2096_low_25 (Length: 236)

Name: NF2096_low_25
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2096_low_25
NF2096_low_25
[»] chr4 (1 HSPs)
chr4 (19-223)||(28340619-28340821)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 223
Target Start/End: Original strand, 28340619 - 28340821
Alignment:
19 cacttttcacctcactcttaactgcttccccttccttcttaacaattaggttaagaannnnnnnnnnnnnnnnnnnncccccgactttcttcaattttcg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                    |||||||||||||||||||||||    
28340619 cacttttcacctcactcttaactgcttccccttccttcttaacaattaggttaagaatctctctctctctctctc--cccccgactttcttcaattttcg 28340716  T
119 aagcttcatatccttcgagttacaacctgcgatctgcttttccgaaattcacctttgtttcaaatgcaaataaattgatcaatgtctcaaccaccactct 218  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
28340717 aagcttcatatccttcgagttacaacctgcgatttgcttttccgaaattcacctttgtttcgaatgcaaataaattgatcaatgtctcaaccaccactct 28340816  T
219 ctgct 223  Q
    |||||    
28340817 ctgct 28340821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University