View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2096_low_27 (Length: 203)
Name: NF2096_low_27
Description: NF2096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2096_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 11 - 69
Target Start/End: Original strand, 45144558 - 45144616
Alignment:
| Q |
11 |
gaagcaaaggtaccctatatatgtctctaattcaatcctttgtattttctctatagtag |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144558 |
gaagcaaaggtaccctatatatgtctctaattcaatcctttgtattttctctatagtag |
45144616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 135 - 184
Target Start/End: Original strand, 45144682 - 45144731
Alignment:
| Q |
135 |
cttgcataatatattatgacaaaatttaggttggagggtaaggtggcaat |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45144682 |
cttgcataatatattatgacaaaatttaggttggagggtaaggtggcaat |
45144731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University