View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20970_high_13 (Length: 239)
Name: NF20970_high_13
Description: NF20970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20970_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 129 - 223
Target Start/End: Original strand, 44983876 - 44983970
Alignment:
| Q |
129 |
taaaatactcacagcattcaaccagaaatcaggaatagatttgataatctcgttccgcttatcgtaaaccggcttcctaatctcattatacttct |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44983876 |
taaaatactcacagcattcaaccagaaatcaggaatagatttgataatctcgttccgcttatcgtaaaccggcttcctaatctcattatacttct |
44983970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 20 - 64
Target Start/End: Original strand, 44983766 - 44983810
Alignment:
| Q |
20 |
aggatggctcaaaaactgcaaacaatgacaaagataaagcacaac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44983766 |
aggatggctcaaaaactgcaaacaatgacaaagataaagcacaac |
44983810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 130 - 189
Target Start/End: Complemental strand, 47528213 - 47528154
Alignment:
| Q |
130 |
aaaatactcacagcattcaaccagaaatcaggaatagatttgataatctcgttccgctta |
189 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||| ||||| | ||||||| |
|
|
| T |
47528213 |
aaaatactcacagcattcaaccagaagttaggaatagatttgatcatctcatcccgctta |
47528154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University