View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20970_high_9 (Length: 341)
Name: NF20970_high_9
Description: NF20970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20970_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 15754323 - 15754240
Alignment:
| Q |
17 |
catttaggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaactaataaattat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
15754323 |
catttaggtggctttaggcttggtaaggaaacagatagtgtaagtagacacataccctgccaataatcaaaacaaatgaattat |
15754240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 22 - 100
Target Start/End: Complemental strand, 15778667 - 15778589
Alignment:
| Q |
22 |
aggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaactaataaattat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
15778667 |
aggtggctttaggcttggtagagaaactgatagtgtaagtagacacataccctgccattaaccaaaactcatgaattat |
15778589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 15765007 - 15764936
Alignment:
| Q |
17 |
catttaggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaa |
88 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
15765007 |
catttaggtggctttaggcttggaagggaaactgatagtgtaagcagacacataccctgccaatcaccaaaa |
15764936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 15736336 - 15736278
Alignment:
| Q |
22 |
aggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaat |
80 |
Q |
| |
|
|||||| ||||||||||| || ||||| ||||||||||| | | ||||||||||||||| |
|
|
| T |
15736336 |
aggtggttttaggcttggaagagaaactgatagtgtaagcatagacataccctgccaat |
15736278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 114 - 216
Target Start/End: Original strand, 28324085 - 28324188
Alignment:
| Q |
114 |
ggcactcttta-gagcttaaaataataagactttatatagatctcggtatttaatgcattgaagattgaattgtttgacttttgaattaaatgcattgga |
212 |
Q |
| |
|
||||||||||| ||| |||||||| ||||| |||||| | || | | ||||||||||||||| |||||||||||| |||||| || ||||||||||||| |
|
|
| T |
28324085 |
ggcactctttaagagtttaaaatagtaagattttataaaaatgtgtgcatttaatgcattgaaaattgaattgtttaactttttaaataaatgcattgga |
28324184 |
T |
 |
| Q |
213 |
ataa |
216 |
Q |
| |
|
|||| |
|
|
| T |
28324185 |
ataa |
28324188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University