View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20970_low_12 (Length: 341)

Name: NF20970_low_12
Description: NF20970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20970_low_12
NF20970_low_12
[»] chr1 (4 HSPs)
chr1 (17-100)||(15754240-15754323)
chr1 (22-100)||(15778589-15778667)
chr1 (17-88)||(15764936-15765007)
chr1 (22-80)||(15736278-15736336)
[»] chr7 (1 HSPs)
chr7 (114-216)||(28324085-28324188)


Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 15754323 - 15754240
Alignment:
17 catttaggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaactaataaattat 100  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||    
15754323 catttaggtggctttaggcttggtaaggaaacagatagtgtaagtagacacataccctgccaataatcaaaacaaatgaattat 15754240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 22 - 100
Target Start/End: Complemental strand, 15778667 - 15778589
Alignment:
22 aggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaactaataaattat 100  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||||| || ||||||    
15778667 aggtggctttaggcttggtagagaaactgatagtgtaagtagacacataccctgccattaaccaaaactcatgaattat 15778589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 17 - 88
Target Start/End: Complemental strand, 15765007 - 15764936
Alignment:
17 catttaggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaataaccaaaa 88  Q
    ||||||||||||||||||||||| |||||||| ||||||||||| ||||||||||||||||||| |||||||    
15765007 catttaggtggctttaggcttggaagggaaactgatagtgtaagcagacacataccctgccaatcaccaaaa 15764936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 22 - 80
Target Start/End: Complemental strand, 15736336 - 15736278
Alignment:
22 aggtggctttaggcttggtagggaaacagatagtgtaagtagacacataccctgccaat 80  Q
    |||||| ||||||||||| || ||||| ||||||||||| | | |||||||||||||||    
15736336 aggtggttttaggcttggaagagaaactgatagtgtaagcatagacataccctgccaat 15736278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 114 - 216
Target Start/End: Original strand, 28324085 - 28324188
Alignment:
114 ggcactcttta-gagcttaaaataataagactttatatagatctcggtatttaatgcattgaagattgaattgtttgacttttgaattaaatgcattgga 212  Q
    ||||||||||| ||| |||||||| ||||| |||||| | || |  | ||||||||||||||| |||||||||||| |||||| || |||||||||||||    
28324085 ggcactctttaagagtttaaaatagtaagattttataaaaatgtgtgcatttaatgcattgaaaattgaattgtttaactttttaaataaatgcattgga 28324184  T
213 ataa 216  Q
    ||||    
28324185 ataa 28324188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University