View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20970_low_20 (Length: 238)
Name: NF20970_low_20
Description: NF20970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20970_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 12 - 215
Target Start/End: Complemental strand, 15471565 - 15471368
Alignment:
| Q |
12 |
ttatacttctaaaatatcttaaaaaatacaactccaaatcttcaacctagctatttctacaatatgcatgaatttataacaactgtcaaatttaaaccat |
111 |
Q |
| |
|
||||||||||| |||||||||||| || |||||||||||||||| |||||||||| ||| |||||||||||||||||||||||| ||||| ||| |
|
|
| T |
15471565 |
ttatacttctaccatatcttaaaaa--actactccaaatcttcaac----atatttctacagtatacatgaatttataacaactgtcaaacttaaaacat |
15471472 |
T |
 |
| Q |
112 |
ggaccacaattttacacctgaataaatatgctggattgcttataaatcccctcatttttgtttaaaatacacacgagccacccattatatgatatgtgaa |
211 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| | ||| |||||||||||||||||| |
|
|
| T |
15471471 |
gaaccacaattttacacctgaataaatatgctggattgcttataaatcccctaatttttgtttaaaatagacacgggtcactcattatatgatatgtgaa |
15471372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University