View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20970_low_8 (Length: 358)
Name: NF20970_low_8
Description: NF20970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20970_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 33120730 - 33120521
Alignment:
| Q |
16 |
tattcatctgagtcgtacttacagaacaatatcgatactttttaatatgtttaattgtttaattaaattcgaga-------taattaattttattaacta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33120730 |
tattcatctgagtcgtacttacagaacaatctcgatactttttaatatttttaattgcttaattaaattcgagaatatgtataattaattttattaacta |
33120631 |
T |
|
| Q |
109 |
tgtagggagcataagcaagaactctcccactatggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaatag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120630 |
tgtagggagcataagcaagaactctcccactatggtcaaaagatcaacatcatcctcagtagactgaggaagcagatcacggtctgtcgtcaacaaatag |
33120531 |
T |
|
| Q |
209 |
gtcagtaaat |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
33120530 |
gtcagtaaat |
33120521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University