View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20972_low_9 (Length: 216)
Name: NF20972_low_9
Description: NF20972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20972_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 3 - 197
Target Start/End: Complemental strand, 38728814 - 38728620
Alignment:
| Q |
3 |
gtgggaattccgacaattgacctttccatggaacggtcagagttgtcggaattagttgtgaaagcttgcgaagaatatggnnnnnnnaaggtggtgaatc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38728814 |
gtgggaattccgacaattgacctttccatggaaaggtcagagttgtcggaattagttgtgaaagcttgcgaagaatatggtttttttaaggtggtgaatc |
38728715 |
T |
|
| Q |
103 |
atggtataccaaaggaggttatttcaaggttggaaaatgaaggaacagagtttttctcaaaaaactcttcagagaaacttcaagctggtacttct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38728714 |
atggtataccaaaggaggttatttcaaggttggaaaatgaaggaacagagtttttctcaaaaaactctacagagaaacttcaagctggtacttct |
38728620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University