View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20974_high_11 (Length: 291)
Name: NF20974_high_11
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20974_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 5396390 - 5396537
Alignment:
| Q |
1 |
atggttactacttattagagtttaataattataggagcaattgggtcctacgattttgtgagtttgtttatgcnnnnnnnnnnnnnnnnnaacatatgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5396390 |
atggttactacttattagagtttaataattataggagcaattgggtcctacgattttgtgagtttgtttatgctttttatttttatttttaacatatgag |
5396489 |
T |
 |
| Q |
101 |
tgagtgtattattatggtttggaaggatgggatgtggatatggtaata |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396490 |
tgagtgtattattatggtttggaaggatgggatgtggatatggtaata |
5396537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 198 - 246
Target Start/End: Original strand, 5396587 - 5396635
Alignment:
| Q |
198 |
tgagttagataggtagatgtttgatatgtttgtttccaaacgagtgaag |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5396587 |
tgagttagataggtagatgtttgatatgtttgtttccaaacgagtgaag |
5396635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University