View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20974_high_13 (Length: 256)
Name: NF20974_high_13
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20974_high_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 3959593 - 3959848
Alignment:
| Q |
1 |
tatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgaggtggtccagaatttttcgttcattcatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
3959593 |
tatgccccttttcctctcaaatttccatttcctcctttttgtaaaaacctaaataagaaaaaccccaatgatgtggtccagaattttttgttcattcatg |
3959692 |
T |
 |
| Q |
101 |
tttggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtacatatatat |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959693 |
tatggaaacccgaatgactataataaccgctagaaaccctttacaatgtggaaattggcagcaaaacattggtttcaaaattattttggtacatatatat |
3959792 |
T |
 |
| Q |
201 |
gccctttatcgttggtgaaacttatagagtaaatatatcccttcttctctgctcct |
256 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3959793 |
gccctttatcgttggtgaaacttatatagtaaatatatcccttcttttctgctcct |
3959848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 168
Target Start/End: Complemental strand, 4021260 - 4021195
Alignment:
| Q |
103 |
tggaaacccgaatgactataataaccgctagaaacccttcacaatgtggaaattggcagcaaaaca |
168 |
Q |
| |
|
||||||||| ||||||| ||| |||| | |||||||||||| |||||||||||||||||||||| |
|
|
| T |
4021260 |
tggaaaccctaatgactctaacaaccaccagaaacccttcaggttgtggaaattggcagcaaaaca |
4021195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University