View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20974_low_10 (Length: 314)
Name: NF20974_low_10
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20974_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 42 - 299
Target Start/End: Complemental strand, 18254074 - 18253817
Alignment:
| Q |
42 |
atagacattaggaacatacatgtcaagtttggagtttatgtcaagtgaaaatgtttcacttagaggtgtcatagcatctttagcagttttcatagttaag |
141 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18254074 |
atagatattagggacatacatgtcaagtttggagttaatgtcaagtgaaaatgtttcacttaaaggtgtcatagcatctttagcagttttcatagttaag |
18253975 |
T |
 |
| Q |
142 |
tccaaagctccagcaattattgttgtttcatggagtgttaactctccacctttccccgcctgattatataaattactttagcatataatgaaattaaaat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18253974 |
tccaaagctccagcaattattgttgtttcatggagtgttaactctccacctttccctgcctgattatataaattactttagcatataatgaaattaaaat |
18253875 |
T |
 |
| Q |
242 |
gttaattaaattatttgattgagtaaaagaagatagttaacctcattggcatgtaaat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18253874 |
gttaattaaattatttgattgagtaaaagaagatagttaacctcattggcatgtaaat |
18253817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University