View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20974_low_11 (Length: 291)

Name: NF20974_low_11
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20974_low_11
NF20974_low_11
[»] chr8 (2 HSPs)
chr8 (1-148)||(5396390-5396537)
chr8 (198-246)||(5396587-5396635)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 5396390 - 5396537
Alignment:
1 atggttactacttattagagtttaataattataggagcaattgggtcctacgattttgtgagtttgtttatgcnnnnnnnnnnnnnnnnnaacatatgag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 ||||||||||    
5396390 atggttactacttattagagtttaataattataggagcaattgggtcctacgattttgtgagtttgtttatgctttttatttttatttttaacatatgag 5396489  T
101 tgagtgtattattatggtttggaaggatgggatgtggatatggtaata 148  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
5396490 tgagtgtattattatggtttggaaggatgggatgtggatatggtaata 5396537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 198 - 246
Target Start/End: Original strand, 5396587 - 5396635
Alignment:
198 tgagttagataggtagatgtttgatatgtttgtttccaaacgagtgaag 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
5396587 tgagttagataggtagatgtttgatatgtttgtttccaaacgagtgaag 5396635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University