View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20974_low_13 (Length: 261)
Name: NF20974_low_13
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20974_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 115 - 240
Target Start/End: Complemental strand, 3090594 - 3090469
Alignment:
| Q |
115 |
ttccaattgctagcaacatttatttattggtaaataaaataaaaccctaggtaatgttttataggttgattaatatatgtttggtttgtccaaattgaga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090594 |
ttccaattgctagcaacatttatttattggtaaataaaataaaaccctaggtaatgttctataggttgattaatatatgtttggtttgtccaaattgaga |
3090495 |
T |
|
| Q |
215 |
aattgaggattagtcattagatatca |
240 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3090494 |
aattgaggattagtcattagatatca |
3090469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 14 - 118
Target Start/End: Original strand, 3090757 - 3090861
Alignment:
| Q |
14 |
aatcatagggttttggtgcttgaacgtggtggatcaccttatgggaatccaaacataaccaatttaagtgcctttggtgttgcactttctgatccatctc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3090757 |
aatcatagggttttggtgcttgaacgtggtggatcaccttatgggaatccaaacataaccaatttaagtgcctttggtgttgcactttctgatccatctc |
3090856 |
T |
|
| Q |
114 |
cttcc |
118 |
Q |
| |
|
||||| |
|
|
| T |
3090857 |
cttcc |
3090861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 14 - 117
Target Start/End: Original strand, 3082401 - 3082504
Alignment:
| Q |
14 |
aatcatagggttttggtgcttgaacgtggtggatcaccttatgggaatccaaacataaccaatttaagtgcctttggtgttgcactttctgatccatctc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||| |||||| |
|
|
| T |
3082401 |
aatcatagggttttggtgcttgaacgtggtggatcaccttatgggaatccaaacataaccaatttaagtgcctatggtgttccactctctgatacatctc |
3082500 |
T |
|
| Q |
114 |
cttc |
117 |
Q |
| |
|
|||| |
|
|
| T |
3082501 |
cttc |
3082504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 115 - 203
Target Start/End: Complemental strand, 3082238 - 3082150
Alignment:
| Q |
115 |
ttccaattgctagcaacatttatttattggtaaataaaataaaaccctaggtaatgttttataggttgattaatatatgtttggtttgt |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||||| || |||||||||||||| ||| | ||||||||| |
|
|
| T |
3082238 |
ttccaattgctagcaacatttacttattggtaaataaaataaaaccttaggtaattttctataggttgattaaaatagggttggtttgt |
3082150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University