View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20974_low_17 (Length: 240)
Name: NF20974_low_17
Description: NF20974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20974_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 18 - 186
Target Start/End: Original strand, 3958396 - 3958558
Alignment:
| Q |
18 |
taattctgtatatgcaactgatcgcaagtgaatggaaattaatctgttttataacaaacatatgtttcttgatttttccttcttgattaaaattaaggct |
117 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958396 |
taattctgtatatgcaactgattgcaaatgaatggaaattaatctgttttataacaaacaaatgtttcttgatttttccttcttgattaaaattaaggct |
3958495 |
T |
|
| Q |
118 |
ataggacaaggacgtgaaaggtaatcgtaagttgtaggttatctttaactttcttctttaaatgagaac |
186 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3958496 |
at------aggacgtgaaaggtaatcgtaagttgtaggttatctttaactttcttctttaaatgagaac |
3958558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 199 - 240
Target Start/End: Original strand, 3959556 - 3959597
Alignment:
| Q |
199 |
agacaccaacatgttggtttgtagtttgccaaaaatatatgc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3959556 |
agacaccaacatgttggtttgtagtttgccaaaaatatatgc |
3959597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 100
Target Start/End: Complemental strand, 4007032 - 4006977
Alignment:
| Q |
46 |
tgaatggaaattaatct-gttttataacaaacatatgtttcttgatttttccttct |
100 |
Q |
| |
|
||||||||||||||||| || |||||||||| | || ||||||||||||||||||| |
|
|
| T |
4007032 |
tgaatggaaattaatcttgtgttataacaaaaaaatatttcttgatttttccttct |
4006977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University