View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20975_high_12 (Length: 265)

Name: NF20975_high_12
Description: NF20975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20975_high_12
NF20975_high_12
[»] chr7 (1 HSPs)
chr7 (23-265)||(29911524-29911766)


Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 23 - 265
Target Start/End: Complemental strand, 29911766 - 29911524
Alignment:
23 cgctgatactgtgatggcgttgtttctcggtcttcttcgtcggactcatctgctttctcgtcatgcgctttcagcttccggttggcttggttctgttcag 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29911766 cgctgatactgtgatggcgttgtttctcggtcttcttcgtcggactcatctgctttctcgtcatgcgctttcagcttccggttggcttggttctgttcag 29911667  T
123 ccgctgtgccgcgggatgcgacggtgtcgtggtcttgttcttggtattgttggtagatctgcttctgctagagctttggctactcggagcttggctttca 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29911666 ccgctgtgccgcgggatgcgacggtgtcgtggtcttgttcttggtattgttggtagatctgcttctgctagagctttggctactcggagcttggctttca 29911567  T
223 aaatgagtgttctctattttgatgttcattcggtaatttcttc 265  Q
    |||||||||||||||||||||||||||||||||||||||||||    
29911566 aaatgagtgttctctattttgatgttcattcggtaatttcttc 29911524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University