View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20975_low_13 (Length: 265)
Name: NF20975_low_13
Description: NF20975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20975_low_13 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 23 - 265
Target Start/End: Complemental strand, 29911766 - 29911524
Alignment:
| Q |
23 |
cgctgatactgtgatggcgttgtttctcggtcttcttcgtcggactcatctgctttctcgtcatgcgctttcagcttccggttggcttggttctgttcag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911766 |
cgctgatactgtgatggcgttgtttctcggtcttcttcgtcggactcatctgctttctcgtcatgcgctttcagcttccggttggcttggttctgttcag |
29911667 |
T |
 |
| Q |
123 |
ccgctgtgccgcgggatgcgacggtgtcgtggtcttgttcttggtattgttggtagatctgcttctgctagagctttggctactcggagcttggctttca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911666 |
ccgctgtgccgcgggatgcgacggtgtcgtggtcttgttcttggtattgttggtagatctgcttctgctagagctttggctactcggagcttggctttca |
29911567 |
T |
 |
| Q |
223 |
aaatgagtgttctctattttgatgttcattcggtaatttcttc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911566 |
aaatgagtgttctctattttgatgttcattcggtaatttcttc |
29911524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University