View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20975_low_14 (Length: 238)
Name: NF20975_low_14
Description: NF20975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20975_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 31521443 - 31521656
Alignment:
| Q |
8 |
agaggagttatatgtaactttgtttgcctattttaacagaaacatattttaatcctgttatnnnnnnnnnnnnnnnntgtaatcccttcattttaaagta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31521443 |
agaggagttatatgtaactttgtttgcctattttaacagaaacatattttaatcctgttataaaaaaagtaaaaaa-tgtaatcccatcattttaaagta |
31521541 |
T |
 |
| Q |
108 |
aggagtgctagcaacacaattttcaacacgatcatcttgattgattaaatttcacatgtcttccatcaaattatttggatcctatatcaattttaaggta |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31521542 |
aggagtgctagcaacacaattttcaacacattcatcttgattgattaaatttcacatgacttccatcaaattatttggattctatatcaattttaaggta |
31521641 |
T |
 |
| Q |
208 |
cttatgtgaacttta |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31521642 |
cttatgtgaacttta |
31521656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University