View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20975_low_9 (Length: 349)
Name: NF20975_low_9
Description: NF20975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20975_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 336
Target Start/End: Original strand, 21780528 - 21780844
Alignment:
| Q |
19 |
acctataatatagactaaaatgagtgattttgaccctcaattttaccttgtttta-acttactaatctttcatgcatgttttgaccaattttgactaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780528 |
acctataatatagactaaaatgagtgattttgaccctcaattttaccttgttttacacttactagtctttcatgcatgttttgaccaattttgactaaaa |
21780627 |
T |
 |
| Q |
118 |
atcaatcacctatgtagctaattttaattacgtgacaataagacccatgtgtttttagagagaagacatacctnnnnnnnnnnnnaacttaacatgcttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
21780628 |
atcaatcacctatgtagctaattttaattacgtgacaataagacccatgtgtttttagagagaaggaggacct--tctctctctgaacttaacatgcttt |
21780725 |
T |
 |
| Q |
218 |
cagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgggtcgccgcacctagg |
317 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21780726 |
cgttcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatctgcctttcccgaccatatgggtcgccgcacctagg |
21780825 |
T |
 |
| Q |
318 |
tgttcctagtccctcccct |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
21780826 |
tgttcctagtccctcccct |
21780844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 203 - 342
Target Start/End: Original strand, 24375392 - 24375531
Alignment:
| Q |
203 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgg |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
24375392 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccagatcttcgtgatctgcctttcccgaccatatgg |
24375491 |
T |
 |
| Q |
303 |
gtcgccgcacctaggtgttcctagtccctcccctttgctt |
342 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
24375492 |
gtcgccgcacctaggtgttcccagtccctcccctctgctt |
24375531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 203 - 342
Target Start/End: Complemental strand, 9106756 - 9106617
Alignment:
| Q |
203 |
aacttaacatgctttcagtcacccaaactagggtttcaccttggttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgg |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
9106756 |
aacttaacatgctttcagtcacccaaactagggtttcaccatggttcaacgacggcaaatcaacccagatcttcgtgatctgcctttcccgaccatatgg |
9106657 |
T |
 |
| Q |
303 |
gtcgccgcacctaggtgttcctagtccctcccctttgctt |
342 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9106656 |
gtcgccacacctaggtgttcctagtccctcccctttgctt |
9106617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 9e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 247 - 338
Target Start/End: Complemental strand, 32021815 - 32021724
Alignment:
| Q |
247 |
ttcagcggcggcaaatcaacccatatcttcgtgatttgcctttcccgaccatatgggtcgccgcacctaggtgttcctagtccctccccttt |
338 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||| |||||| |||||||||||||||| || | |||||||||||||||| | |||||||| |
|
|
| T |
32021815 |
ttcagcggcggcaaaacaacccagatcatcgtgatctgccttccccgaccatatgggtcaccactcctaggtgttcctagttcttccccttt |
32021724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University