View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20976_high_13 (Length: 303)
Name: NF20976_high_13
Description: NF20976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20976_high_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 31 - 292
Target Start/End: Complemental strand, 15557903 - 15557642
Alignment:
| Q |
31 |
tatcctcttcatttgtaaattgtgtggctgccaactaatgagggactatgcttgtagcctgctgcagtgtgggaaccataatatccttgtccaacaacac |
130 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| || |
|
|
| T |
15557903 |
tatcctcctcatttgtaaattgcgtggctgccaactaatgagggactatgcttgtagcctgctgctctgtgggaaccgtaatatccttgtccaacaatac |
15557804 |
T |
 |
| Q |
131 |
cctcttgggaatagaaacatcctgctggccaatgtccacagaggcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgt |
230 |
Q |
| |
|
||||||||||||||||||||| ||||| | |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15557803 |
cctcttgggaatagaaacatcttgctgactaatgtccacagaggcaaaggcctttgaagatccaatgccctccagattatccttagacttccacgtttgt |
15557704 |
T |
 |
| Q |
231 |
tttgatctttgcgaatgaaccggttgcttcccgttatcaatagttttctttccaacgtctgt |
292 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15557703 |
tttgatctttatgaatgaaccggttgcttcccgttatcaatagttttctttccaacgtctgt |
15557642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 174 - 288
Target Start/End: Complemental strand, 24026496 - 24026382
Alignment:
| Q |
174 |
gcaaatgcctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatcaatag |
273 |
Q |
| |
|
||||| |||||||| || | ||||||||| ||||||||||| | ||||| | |||||||| | ||||||||||||||||||||| ||||||||||| | |
|
|
| T |
24026496 |
gcaaacgcctttgaggacctaatgccctccggattatccttcggtttccaggcttgttttggttgttgcgaatgaaccggttgcttaccgttatcaattg |
24026397 |
T |
 |
| Q |
274 |
ttttctttccaacgt |
288 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24026396 |
ttttctttccaacgt |
24026382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 174 - 214
Target Start/End: Complemental strand, 24056339 - 24056299
Alignment:
| Q |
174 |
gcaaatgcctttgaagatccaatgccctctggattatcctt |
214 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24056339 |
gcaaacgcctttgatgatccaatgccctctggattatcctt |
24056299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 269
Target Start/End: Original strand, 22392562 - 22392650
Alignment:
| Q |
181 |
cctttgaagatccaatgccctctggattatccttagacttccacgtttgttttgatctttgcgaatgaaccggttgcttcccgttatca |
269 |
Q |
| |
|
||||||| || ||||| ||||| || |||||||| | |||||| |||||||||||| |||| ||||| || || ||||| || |||||| |
|
|
| T |
22392562 |
cctttgaggagccaattccctccgggttatccttcggcttccaagtttgttttgatttttgtgaatggactggctgctttcctttatca |
22392650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University