View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20976_high_23 (Length: 246)
Name: NF20976_high_23
Description: NF20976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20976_high_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 30762121 - 30761971
Alignment:
| Q |
1 |
tcttcaagctttgcagcaacatcgctctgatggccattagatcattcgattatacaaggtgcacaagttaccatcatatatcaatactaattatgccata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30762121 |
tcttcaagctttgcagcaacatcgctctgatggccattagatcgatc-atta--caaggtgcacaatttaccatcatatatcaatactaattatgccata |
30762025 |
T |
 |
| Q |
101 |
tgtcatataattgcatattcaatactttgttgaaatatctcttcattttacatt |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
30762024 |
tgtcatataattgcatattcaatattttgttaaaatatctcttcattttacatt |
30761971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 30751680 - 30751588
Alignment:
| Q |
1 |
tcttcaagctttgcagcaacatcgctctgatggccattagatcattcgattatacaaggtgcacaagttaccatcatatatcaatactaattat |
94 |
Q |
| |
|
||||||||| || ||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
30751680 |
tcttcaagccttccagcaccatcgctctaatggccattagatcattcgattatacaaggtgcacaatttaccatcatat-tcaatactaattat |
30751588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University