View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20976_high_26 (Length: 236)
Name: NF20976_high_26
Description: NF20976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20976_high_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32789771 - 32789551
Alignment:
| Q |
1 |
tgctttgttggatatgatggtaacccttttggaaatggcataagaggaagttgacaaaattgctttggaagatgaagccttaatctatcataagttttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789771 |
tgctttgttggatatgatggtaacccttttggaaatggcataagaggaagttgacaaaattgctttggaagatgaagccttaatctatcataagttttga |
32789672 |
T |
|
| Q |
101 |
gttgccacattgaagctaaacaattagctctttcaaggatttgacttggaattcctttttgtttaagacatgctgctgctgctaatcctgagggaccagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32789671 |
gttgccacattgaagctaaacaattagctctttcaaggatttgacttggaattcctttttgtttaagacatgctgctgctgctaatcctgagggaccagc |
32789572 |
T |
|
| Q |
201 |
tccaactataattggtccatg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32789571 |
tccaactataattggtccatg |
32789551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 185
Target Start/End: Complemental strand, 50667509 - 50667382
Alignment:
| Q |
58 |
aattgctttggaagatgaagccttaatctatcataagttttgagttgccacattgaagctaaacaattagctctttcaaggatttgacttggaattcctt |
157 |
Q |
| |
|
||||| |||||||||||||| | |||| ||| || |||||||||||||| | |||||| | |||||||| |||||| || ||| || |||||| || |
|
|
| T |
50667509 |
aattgttttggaagatgaagacgcaatcgatcgtaggttttgagttgccataatgaagccacacaattagatctttctagtattacacatggaatgtttt |
50667410 |
T |
|
| Q |
158 |
tttgtttaagacatgctgctgctgctaa |
185 |
Q |
| |
|
|||||| |||||||| ||||||||||| |
|
|
| T |
50667409 |
tttgttgtagacatgcagctgctgctaa |
50667382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University