View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20976_high_6 (Length: 392)
Name: NF20976_high_6
Description: NF20976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20976_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 358; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 358; E-Value: 0
Query Start/End: Original strand, 7 - 376
Target Start/End: Original strand, 14738578 - 14738947
Alignment:
| Q |
7 |
tcgaagaatatttattccaacatttgaaagcttttcaaccatattatcaacagctgcattggtaggtgctgtgacaagaaccctttcaccttgttccacg |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14738578 |
tcgaacaatatttattccaacatttgaaagcttttcaaccatattatcaacagctgcattggtaggtgctgtgacaagaaccctttcaccttgttccacg |
14738677 |
T |
 |
| Q |
107 |
gcgcatgttattatttgcttgagtaaaccggtcttgcctgtaccgggaggtccttggataaccaatagtggcctcttcttattcaaacctaacgcaattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14738678 |
gcgcatgttattatttgcttgagtaaaccggtcttgcctgtaccgggaggtccttggataaccaatagtggcctcttcttattcaaacctaacgcaattg |
14738777 |
T |
 |
| Q |
207 |
ctctctgctgagatttatcaaaggattcacttcctaatgctccatttgttttttcttcttcccagtttaccaaactattcttctcaagccatgcagcatc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14738778 |
ctctctgctgagatttatcaaaggattcacttcctaatgctccatttgttttttcttcttcccagtttaccaaactattcttctcaagccatgcagcatc |
14738877 |
T |
 |
| Q |
307 |
ttctgcttcaccgaatagagttgcaacaacagaaattgatggatttttcttttgcaaaccattcttctga |
376 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14738878 |
ttctgcttcgccaaatagagttgcaacaacagaaattgatggatttttcttttgcaaaccattcttctga |
14738947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University